In this section you will learn how to translate a nucleic acid sequence into an amino acid sequence.

A mutation in a nucleic acid or gene sequence will ultimately affect the protein made from it.  To determine which amino acid is affected by the sickle cell anemia mutation, we need to obtain the wild type and mutant beta-globin protein sequences.  There are two ways to do this using the Biology Workbench.  The first way to obtain protein sequences in the Workbench is to use exactly the same approach as we took to find the wild type and mutant nucleic acid sequences but using the “Protein Tools” instead of the “Nucleic Tools”.  The second way is to convert the nucleic acid sequences that we have already obtained into amino acid sequences using a tool called “SIXFRAME”.  This tool translates a nucleic acid sequence into SIX different amino acid sequences or “Reading Frames”. 

Why SIX different Reading Frames?

The first thing to remember is that DNA is double-stranded but, for any one particular gene, the gene sequence occurs on just one of the two DNA strands – which one?  Often, which DNA strand carries the gene sequence is not known so both DNA strands have to be translated into amino acid sequence.  That explains 2 of the 6 reading frames.  What about the other 4?

The second thing to remember is that 3 bases in a mRNA sequence correspond to one amino acid

– that is, the DNA sequence (after first being converted into a mRNA sequence) is translated in groups of 3 bases.  But where does translation start on the mRNA?  Once again, the place in the mRNA where translation starts is often not known so the entire mRNA sequence is translated.  Furthermore, because the mRNA sequence is translated in groups of 3 bases and the location of the first base is usually not known, the entire mRNA sequence has to be translated in 3 different “Reading Frames”.  For example, consider the following mRNA sequence.  There are 3 different reading frames depending on whether translation starts at the first A, the second A, or the first U:

AAUGACUACAUUCGACAUGUAAGA

Frame 1:         AAU GAC UAC AUU CGA CAU GUA AGA

Frame 2:         AUG ACU ACA UUC GAC AUG UAA GA

Frame 3:         UGA CUA CAU UCG ACA UGU AAG A

Therefore, the sequence of each DNA strand (after first being converted into a mRNA sequence) has to be translated into 3 different reading frames – hence the SIX different frames!  However, since your wild type and mutant beta-globin sequences are actually mRNA sequences (to get around the problem of introns), you do NOT need to generate six different reading frames because the decision of which DNA strand contains the gene sequence has already been made for you (your sequence is already a mRNA sequence).  Consequently, all you need is 3 different frames in order to find the correct reading frame within that one mRNA sequence.

Click to see a video demo of steps 1-4 for the wild type sequence. In order to play the video, you should have flashplayer plugin installed. You can download the plugin from

Click to see a video demo of steps 1-4 for the mutant sequence. In order to play the video, you should have flashplayer plugin installed. You can download the plugin from

1. Selecting the Translation program

            Select the wild type sequence (GBPRI:29436)

            Scroll down the menu and highlight the line SIXFRAME - Generate & Import 6 frame translation on a NS

            Click on the Run button

2. Setting up the translation parameters.

            Go to the third slot for Frame to Translate and click on the pull down menu

            Select the choice 3 Forward Frames

            Deselect the first item from the list Show longest open reading frame

            Click the Submit button

3. Examining the results of the translation.  On the results screen you will see the 3 different reading frames (numbered 1 through 3).  It is comparatively easy to tell which reading frame is the correct one.  The first step is to find out how many stop codons there are in each frame.  The stop codons are indicated by asterisks (*).  The correct reading frame will contain a long stretch of amino acid sequence with no stop codons.  Take a look at each frame in turn.

            Frame 1 has 7 stop codons scattered throughout the sequence

            Frame 2 has 14 stop codons.

            Frame 3 has 5 stop codons

4. Select the appropriate reading frame.

            From the previous step, the third frame is the correct translation frame

            Select that record by clicking on the box next to its name

            Click the Import Sequences(s) button

            When this operation is done, a new screen will show up; check to make sure that the record has been imported, it should appear on this screen (GBPRI:29436, SIXFRAME…)

            To go back to the main page of the session where your original dna sequences are, just click on Nucleic Tools located across the screen close to the top of the page.

Follow the same four steps to translate the mutant sequence too. The correct reading frame is frame 1 with three stop codons.

Click to see a video demo of steps 5-6. In order to play the video, you should have flashplayer plugin installed. You can download the plugin from

5. Select the sequences to be edited. In their current state, both translated sequences cannot be used as input to other tools. We need to remove the stop codons and chop off the part of the sequence before or after a stop codon.

            From the main page of the Sickle Cell Anemia session choose the Protein Tools button

            Scroll down the window and highlight the line Edit Protein Sequence(s)

            Select both sequences from the list below the window by clicking on the box in front of    each sequence

            Click the Run button

            A new window will show the contents of the sequences

6. Editing the sequences.  In the box labeled Sequence you will see the sequence in fasta format; that is, the first line starts with the > symbol followed by a string describing the sequence the rest of the lines are the actual residues of the sequence.

            Check the contents of the actual sequence and locate the first occurrence of the amino acid methionine (M), such residue is called the 'initiator methionine' or 'initiator codon'

            Delete all residues from the sequence that come before the initiator codon.

            Then, locate the first asterisk, stop codon, and delete the asterisk AND all the residues from the sequence that come after that asterisk.

            Remember to edit both sequences.

            When done editing, scroll down the page and click on the Save botton

            You will be taken back to the sickle cell anemia main page; check that it lists the two edited sequences

Click to see a video demo of steps 7-9. In order to play the video, you should have flashplayer plugin installed. You can download the plugin from

7. Aligning the sequences. Now that the sequences have been cleaned up, we can align them.

            From the main page of the Sickle Cell Anemia session, click the Protein Tools button

            Select BOTH sequences, the edited ones

            Scroll down the window and highlight the CLUSTALW program

            Click the Run button

            Another window appears to set the CLUSTALW parameters

            Scroll down the screen and click the Submit button

8. Examining the results.  Check the results page. The first difference between the sequences is at the seventh position of each sequence; such difference represents the mutation that causes sickle cell anemia.  In the wild type protein this amino acid is a glutamic acid (E) but in the mutant protein the glutamic acid is replaced by a valine (V).

The second difference between the sequences is at the 15th position of each sequence, appears simply because this amino acid is unresolved in the mutant beta-globin sequence, hence the X, and does not represent a true difference between the two sequences.

9. Identifying the site of the mutation. From the previous step, it is clear that the site of the mutation is at the seventh position.

Conclusion

Using various tools in the Workbench, you have shown that the mutation responsible for sickle cell anemia is caused by the substitution of a single base in the gene for one of the beta-globin chains of hemoglobin.  This single base change results in a different amino acid being inserted into the final protein – instead of a glutamic acid residue, the mutant protein contains a valine.  What effect does this single amino acid change have on the hemoglobin molecule that could lead to such a terrible disease?  In the next part of this tutorial, you are going to use a 3D-modeling tool to visualize the wild type and mutant proteins to see how the mutation affects the structure of the hemoglobin molecule.